View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7523_high_60 (Length: 208)
Name: NF7523_high_60
Description: NF7523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7523_high_60 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 57 - 190
Target Start/End: Original strand, 47729435 - 47729567
Alignment:
| Q |
57 |
agcatttagatgaagtttattttacacaacaccaattatgcaaaaaaggaagataaatagtggtacctttgaatgtctcccatgggtagataataccatc |
156 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47729435 |
agcatttagatgaagtttattttacaca-caccaattatgcaaaaaatgaagataaatagtggtacctttgaatgtctcccatgggtagataataccatc |
47729533 |
T |
|
| Q |
157 |
attgtcaatgtcgaagaaggatgcatgttgttga |
190 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
47729534 |
attgtcaatgtcgaagaaggctgcatgttgttga |
47729567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University