View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7523_high_62 (Length: 204)

Name: NF7523_high_62
Description: NF7523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7523_high_62
NF7523_high_62
[»] chr2 (1 HSPs)
chr2 (101-204)||(8914609-8914712)


Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 101 - 204
Target Start/End: Complemental strand, 8914712 - 8914609
Alignment:
101 atcacgctgagcaaaattagaagacatgctcatcccaactgtattaccaccttaatacattaacaatcatatacaccaccccaaaaatatcatttgataa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
8914712 atcacgctgagcaaaattagaagacatgctcatcccaactgtattaccaccttaacacattaacaatcatatacaccaccccaaaaatatcatttgataa 8914613  T
201 gaaa 204  Q
    ||||    
8914612 gaaa 8914609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University