View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7523_low_14 (Length: 412)
Name: NF7523_low_14
Description: NF7523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7523_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-122; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-122
Query Start/End: Original strand, 20 - 258
Target Start/End: Original strand, 38324241 - 38324479
Alignment:
| Q |
20 |
ttgcggagatcagaaacttgtgtagactggtatgtcttatgaaggacagaaatggacaccaaacacgaattttgagtgcccaacattgttggacacgcct |
119 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
38324241 |
ttgcggagatcagaaacttgtgtagactgttatgtcttatgaaggacagaaatggacaccaaacacgaattttgagtgcccaacattgttggacacacct |
38324340 |
T |
|
| Q |
120 |
tcagtttaaaatatcggtgttacaagtgttaagaagtgcactcaaatgcagccttggctcccctctgagagagggaaactttgcaggcatcagattaatc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38324341 |
tcagtttaaaatatcggtgttacaagtgtaaataagtgcactcaaatgcagccttggctcccctctgagagagggaaactttgcaggcatcagattaatc |
38324440 |
T |
|
| Q |
220 |
acacacttcttctgtatcaatgtaagtttctttgctgcc |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38324441 |
acacacttcttctgtatcaatgtaagtttctttgctgcc |
38324479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 320 - 412
Target Start/End: Original strand, 38325284 - 38325376
Alignment:
| Q |
320 |
gcaaattctaattggctaggtttaagaacaatgacggtaaccaatacaatatacttcaaagtaatcaatgactaaaacaaatacaaatttaag |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38325284 |
gcaaattctaattggctaggtttaagaacaatgactgtaaccaatacaatatacttcaaagtaatcaatgactaaaacaaatacagatttaag |
38325376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University