View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7523_low_36 (Length: 295)
Name: NF7523_low_36
Description: NF7523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7523_low_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 5e-56; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 164 - 286
Target Start/End: Original strand, 40273645 - 40273767
Alignment:
| Q |
164 |
tcaaaaccctctctaactcttcgagttttttagtttacccaagatctaaattttcttgaaccatgacatttagtacaactttgaagaataaaagcaacaa |
263 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40273645 |
tcaaaaccctccctaactcttcgagttttttaatttacccaagatctaaattttcttgaaccatgacatttagtacaactttgaagaataaaagcaacaa |
40273744 |
T |
 |
| Q |
264 |
aagacataatgcatcatattctt |
286 |
Q |
| |
|
||||||||||||||||| ||||| |
|
|
| T |
40273745 |
aagacataatgcatcattttctt |
40273767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 164 - 291
Target Start/End: Complemental strand, 40274589 - 40274462
Alignment:
| Q |
164 |
tcaaaaccctctctaactcttcgagttttttagtttacccaagatctaaattttcttgaaccatgacatttagtacaactttgaagaataaaagcaacaa |
263 |
Q |
| |
|
||||| ||||| ||||||| | | ||||||||||| || || ||||||||||||||||||||| ||||| | || ||||||||| ||||||| |||||| |
|
|
| T |
40274589 |
tcaaacccctccataactctccaaattttttagttttcctaatatctaaattttcttgaaccatcacattaaatataactttgaaaaataaaaacaacaa |
40274490 |
T |
 |
| Q |
264 |
aagacataatgcatcatattcttcgaca |
291 |
Q |
| |
|
||||| ||||||| | ||||| |||| |
|
|
| T |
40274489 |
gagacaatatgcatcgtcttctttgaca |
40274462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 117 - 157
Target Start/End: Original strand, 40273098 - 40273138
Alignment:
| Q |
117 |
atattgcgctaggaagaacataatataaatagacacacaat |
157 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40273098 |
atattgtgctaggaagaacataatataaatagacacacaat |
40273138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University