View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7523_low_39 (Length: 280)

Name: NF7523_low_39
Description: NF7523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7523_low_39
NF7523_low_39
[»] chr1 (1 HSPs)
chr1 (90-261)||(31960174-31960350)


Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 90 - 261
Target Start/End: Complemental strand, 31960350 - 31960174
Alignment:
90 tacaatggaatttgggaagtaagagaaatattatttttaataaaaaatttccatttcttgtttttgttaaag-----agtgctccaagaacatcgattaa 184  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||     |||||||||||||||||||||||    
31960350 tacaatggaatttggaaagtaagagaaatattatttttaataaaaaatttccattttttgtttttgttaaagctaagagtgctccaagaacatcgattaa 31960251  T
185 tatgactcataaaacaatatcacaaggtaagaaaagttaccgatacgacatcacccaatgtagttttctgcagatca 261  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31960250 tatgacgcataaaacaatatcacaaggtaagaaaagttaccgatacgacatcacccaatgtagttttctgcagatca 31960174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University