View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7523_low_65 (Length: 204)
Name: NF7523_low_65
Description: NF7523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7523_low_65 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 101 - 204
Target Start/End: Complemental strand, 8914712 - 8914609
Alignment:
| Q |
101 |
atcacgctgagcaaaattagaagacatgctcatcccaactgtattaccaccttaatacattaacaatcatatacaccaccccaaaaatatcatttgataa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8914712 |
atcacgctgagcaaaattagaagacatgctcatcccaactgtattaccaccttaacacattaacaatcatatacaccaccccaaaaatatcatttgataa |
8914613 |
T |
 |
| Q |
201 |
gaaa |
204 |
Q |
| |
|
|||| |
|
|
| T |
8914612 |
gaaa |
8914609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University