View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7524_high_7 (Length: 275)
Name: NF7524_high_7
Description: NF7524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7524_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 34 - 256
Target Start/End: Original strand, 5972823 - 5973029
Alignment:
| Q |
34 |
gacggtcgaaactttcctccaagtcagaaccactcaaacaaagaatattatttgatgtaataactccacgatcaagtttgctnnnnnnnnnnnnnnnnnn |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5972823 |
gacggtcgaaactttcctccaagtcagaaccactcaaacaaagaatattatttgatgtaataactccacgatcaaatttgct------aaaaaaaaaaaa |
5972916 |
T |
|
| Q |
134 |
ctccacgatcaagtaaattgtcatttgtagggatctattacataataaacgtcaaacaaacaaagagatcttcagaggagatattatatccccaataatg |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
5972917 |
ctccacgatcaagtaaattgtcatttgtagggatctattacataacaaacgttaaacaaacaa----------agaggagatattgtatccccaataatg |
5973006 |
T |
|
| Q |
234 |
tatgaggtatctagtagatcaac |
256 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
5973007 |
tatgaggtatctagtagatcaac |
5973029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University