View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7525_high_6 (Length: 364)
Name: NF7525_high_6
Description: NF7525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7525_high_6 |
 |  |
|
| [»] scaffold0041 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0041 (Bit Score: 133; Significance: 4e-69; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 179 - 347
Target Start/End: Original strand, 14965 - 15133
Alignment:
| Q |
179 |
ccccctcctggttttcttattcgcgcacttccggcttttatacccgcgcttttgatttcgataggatatgttgaccctggaaagtgggtggcaagtatag |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14965 |
ccccctcctggttttcttattcgcgcacttccggctgttatacccgcgcttttgatttcgataggatatgttgaccctggaaagtgggtggcaagtatag |
15064 |
T |
 |
| Q |
279 |
aaggtggtgcgaggtttggttttcgtctcatgacttttactcttattttcaattttgccgctatcttct |
347 |
Q |
| |
|
||||||||||||||||||||||| ||| || ||||| | || ||||||||||||||||||||||||| |
|
|
| T |
15065 |
aaggtggtgcgaggtttggttttgatctggtggcttttgcgctaattttcaattttgccgctatcttct |
15133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 19 - 141
Target Start/End: Complemental strand, 26458921 - 26458799
Alignment:
| Q |
19 |
tggaacgaaccagcgcgtctccttgaatttcatcccttccacttcgaagctcaatttcattcaactaagatatctcgtttcaatccaccgtcacaatgct |
118 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26458921 |
tggaacgaaccagcgcggctccttgaatttcatcccttccacttcgaagctcaatttcattcaactaagatatctcgtttcaatccaccgtcacaatgct |
26458822 |
T |
 |
| Q |
119 |
tcacaacaagtcctttgctaaga |
141 |
Q |
| |
|
||||||||||||||||| ||||| |
|
|
| T |
26458821 |
tcacaacaagtcctttgttaaga |
26458799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 144 - 256
Target Start/End: Complemental strand, 26458576 - 26458464
Alignment:
| Q |
144 |
agcaattgagttctgaacagaccaagagtaaaatgccccctcctggttttcttattcgcgcacttccggcttttatacccgcgcttttgatttcgatagg |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26458576 |
agcaattgagttctgaacagaccaagagtaaaatgccccctcctggttttcttattcgcgcacttccggcttttatacccgcgcttttgatttcgatagg |
26458477 |
T |
 |
| Q |
244 |
atatgttgaccct |
256 |
Q |
| |
|
||||||||||||| |
|
|
| T |
26458476 |
atatgttgaccct |
26458464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 48 - 133
Target Start/End: Complemental strand, 30968489 - 30968405
Alignment:
| Q |
48 |
tcatcccttccacttcgaagctcaatttcattcaactaagatatctcgtttcaatccaccgtcacaatgcttcacaacaagtcctt |
133 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||||||| ||| |||||||| ||||||||||||||||||||| |
|
|
| T |
30968489 |
tcatcacttccacttcgaagctcaatttcaa-caactaagatatctcgtttgaattcaccgtcaaaatgcttcacaacaagtcctt |
30968405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University