View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7525_low_9 (Length: 267)
Name: NF7525_low_9
Description: NF7525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7525_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 15 - 249
Target Start/End: Complemental strand, 35205709 - 35205475
Alignment:
| Q |
15 |
tggtgttgttccggctattgttaaagttttaggttcttcggataaaggttatgttgttaatgattgtttagcggttttggtagcattggcggagaatgtg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35205709 |
tggtgttgttccggctattgttaaagttttaggttcttcggataaaggttatgttgttaatgattgtttagcggttttggtagcattggcggagaatgtg |
35205610 |
T |
|
| Q |
115 |
gatggtgctcgtgctgtattagaatgctcgggtttgtcattggttattgggattttgcaatctgcaaattcgagtgcggagaaggagtactgtgtttcca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35205609 |
gatggtgctcgtgctgtattagaatgctcgggtttgtcattggttattgggattttgcaatctgcaaattcgcgtgcggagaaggagtactgtgtttcca |
35205510 |
T |
|
| Q |
215 |
ttttggtttcactatgtgttaatgttggtggagag |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
35205509 |
ttttggtttcactatgtgttaatgttggtggagag |
35205475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University