View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7527_high_2 (Length: 517)
Name: NF7527_high_2
Description: NF7527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7527_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-137; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 8 - 298
Target Start/End: Complemental strand, 7683104 - 7682810
Alignment:
| Q |
8 |
ttggtgttggcggaagttttaagggtcgaggttcgcttcgaagtgatggaaggagttgatgaatttaggggaggatgtgggttggaattggttcaaaaat |
107 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7683104 |
ttggggttggcggaagttttaagg-tcgaggttcgcttcgaagtgatggaaggagttgatgaatgtagaggaggatgtgggttggaattggttcaaaaat |
7683006 |
T |
|
| Q |
108 |
agggtggtgagaaaggttgataatagtcattttacgagtttttggagggacaaatgggttgg-----aaatgccccctttgttatgcattccctcacctt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
7683005 |
agggtggtgagaaaggttgataatagtcattttacgagtttttggagggacaaatgggttggaaattaaatgccccctttgtgatgcattccctcacctt |
7682906 |
T |
|
| Q |
203 |
ttctctttttctactaaaaaagaggctctggtgggggacctttgggccttgacagacggtgtggggggatggtcgtttgtttggaggagataacct |
298 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7682905 |
ttctctttttctactaaaaaaaaggctctggtgggggacctttgggccttgacagacggtgtggggggatggtcgtttgtttggaggagataacct |
7682810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 334 - 396
Target Start/End: Complemental strand, 7682811 - 7682749
Alignment:
| Q |
334 |
ctattcaagggtttagaggaggggtggaggaggatgtttggtagtggatttcagatgaggatg |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7682811 |
ctattcaagggtttagaggaggggtggaggaggatgcttggtagtggatttcagatgaggatg |
7682749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 128 - 383
Target Start/End: Original strand, 16196086 - 16196356
Alignment:
| Q |
128 |
taatagtcattttacgagtttttggagggacaaatgggttggaaatgccccc--tttgttatgcattccctcaccttttctctttttctactaaaaaaga |
225 |
Q |
| |
|
|||| ||| |||||| |||||||||| ||| |||||||||||||| ||||| ||||| | |||||||||| | |||||||| ||||||||||| |||| |
|
|
| T |
16196086 |
taatggtcgttttacaagtttttggaaggaaaaatgggttggaaactccccccatttgtgaggcattccctctcattttctctctttctactaaataaga |
16196185 |
T |
|
| Q |
226 |
ggctctggtgggggacctttgggccttgacaga--------cggtgtggggggatggtcgtttgtttggaggagataacctttcaattggggaaaggatt |
317 |
Q |
| |
|
||||| |||||| ||||| || ||| ||||| || | |||||||| ||||||||||| | |||||| ||||||||| |||| | |||| | |
|
|
| T |
16196186 |
ggctccagtggggagccttttggtcttaacagaggttggggggggggggggggattgtcgtttgtttaggggagattacctttcaaatgggaagaggact |
16196285 |
T |
|
| Q |
318 |
ta---aa--agttgttagatactattcaagggtttagaggaggggtggaggaggatgtttggtagtggatt |
383 |
Q |
| |
|
|| || ||| ||| | ||| ||||||||||||||||||||||||| ||||||| |||| ||||||| |
|
|
| T |
16196286 |
tacttaatgagtggtttgtcactcttcaagggtttagaggaggggtggatgaggatgcttggcggtggatt |
16196356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 421 - 496
Target Start/End: Original strand, 16196401 - 16196474
Alignment:
| Q |
421 |
ataaggtgttggaggagtgttttcttcttgatggtgagtccaataggttggaggagggattttttgaataccttag |
496 |
Q |
| |
|
|||||||||| | ||| |||||||||||||||||||| ||||||||||| | ||||| ||||||||||||||||| |
|
|
| T |
16196401 |
ataaggtgttatacgagggttttcttcttgatggtgag-ccaataggttgcaagaggg-ttttttgaataccttag |
16196474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 410 - 475
Target Start/End: Complemental strand, 7488531 - 7488466
Alignment:
| Q |
410 |
tagatcttcttataaggtgttggaggagtgttttcttcttgatggtgagtccaataggttggagga |
475 |
Q |
| |
|
|||||| |||||||||||||| |||||| | || |||||||||||||| |||| || ||||||||| |
|
|
| T |
7488531 |
tagatcgtcttataaggtgttagaggagggattgcttcttgatggtgaatccactacgttggagga |
7488466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University