View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7527_low_6 (Length: 226)
Name: NF7527_low_6
Description: NF7527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7527_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 21227811 - 21227602
Alignment:
| Q |
1 |
aaagactatatttcattaagaaattaaatcatcaaaatacagattgtgggcttgggctgggacattttccaaccaaacctgattaggtgctgtggttgcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
21227811 |
aaagactatatttcattaagaaattaaatcatcaaaatatagattttgggcttgggctgggacattttccagccaaacctgattaggtgttgtggttgcc |
21227712 |
T |
|
| Q |
101 |
atatgggccaaggaatgggccacaacgttaccacttctatttacatgagtaaacctaatttatatctatgcttaaattacctttgagagtaagactccac |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21227711 |
atatgggccaagcaatgggccacaacgttaccacttctatttacatgagtaaacctaatttatatctatgcttaaattacctttgagagtaagactccac |
21227612 |
T |
|
| Q |
201 |
gctacaaact |
210 |
Q |
| |
|
||||||||| |
|
|
| T |
21227611 |
actacaaact |
21227602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University