View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7528_low_3 (Length: 379)
Name: NF7528_low_3
Description: NF7528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7528_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 82; Significance: 1e-38; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 257 - 362
Target Start/End: Complemental strand, 36749834 - 36749730
Alignment:
| Q |
257 |
aactaatttaatttttatcgagctgatccgaattaaattcgactcatttccgatcctgattttgacaaactaaattaataaatttgtactttaattaata |
356 |
Q |
| |
|
|||||||||||||||||| ||| ||| | |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36749834 |
aactaatttaatttttattgagttgagctgaattaaattcgactcatttccgatcct-attttgacaaactaaattaataaatttgtactttaattaata |
36749736 |
T |
|
| Q |
357 |
aaaagt |
362 |
Q |
| |
|
|||||| |
|
|
| T |
36749735 |
aaaagt |
36749730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 49 - 119
Target Start/End: Complemental strand, 36750044 - 36749974
Alignment:
| Q |
49 |
agtagtactatgactattcatagtgctgcgttgatttctcatttacttaagcggtcttaggattggttgaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36750044 |
agtagtactatgactattcatagtgccgcgttgatttctcatttacttaagcggtcttaggattggttgaa |
36749974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 36750542 - 36750486
Alignment:
| Q |
1 |
aatcttaatttactaattatcacatgttgatatgggaatatgatcggtagtagtacta |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36750542 |
aatcttaatttactaattatcacatgttgatatgggaata-gatcggtagtagtacta |
36750486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University