View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7528_low_5 (Length: 307)
Name: NF7528_low_5
Description: NF7528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7528_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 21 - 292
Target Start/End: Original strand, 24454954 - 24455222
Alignment:
| Q |
21 |
actataacatttccttcataggatttatgttaaccattctaaattatgtctttaattggtttttattttgaatatgaacaactcattctatcacagttta |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24454954 |
actataacatttccttcataggatttatgttaaccattctaaattatgtctttaattggtttttattttgaatatgaacaactcattctatcacagttta |
24455053 |
T |
|
| Q |
121 |
gttttctattttaaacaaatttaacaccaccaacataggatgaagcaggagtatcaaaatcaagttttgtttgatggnnnnnnnntcttacttgactatg |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| || |
|
|
| T |
24455054 |
gttttctattttaaacaaatttaacaccaccaacataggatgaagcaggagtatcaaaatcaagttttgtttgatgg-gaaaaaatcttactttactgtg |
24455152 |
T |
|
| Q |
221 |
gttgcaggttgcaatctttatgttannnnnnnnncttccttattttatggatggtggtgtggctagatttga |
292 |
Q |
| |
|
|||||||||||||||| ||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
24455153 |
gttgcaggttgcaatc-ttatgtt-tttttttttcttccgtattttatggatggtggtgtggctagatttga |
24455222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 113 - 197
Target Start/End: Complemental strand, 1615648 - 1615565
Alignment:
| Q |
113 |
acagtttagttttctattttaaacaaatttaacaccaccaacataggatgaagcaggagtatcaaaatcaagttttgtttgatgg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
1615648 |
acagtttagttttctattttaaacaaatttaacaccaccaacatagcatgaagca-gagtatcaaaatcaagtattgtttgatgg |
1615565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 292
Target Start/End: Complemental strand, 1615500 - 1615466
Alignment:
| Q |
258 |
ccttattttatggatggtggtgtggctagatttga |
292 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1615500 |
ccttattttatggatggtggtgtggctaggtttga |
1615466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 256 - 292
Target Start/End: Original strand, 43227416 - 43227452
Alignment:
| Q |
256 |
ttccttattttatggatggtggtgtggctagatttga |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43227416 |
ttccttattttatggatggtggtgtggctaggtttga |
43227452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University