View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7528_low_6 (Length: 284)
Name: NF7528_low_6
Description: NF7528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7528_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 2 - 217
Target Start/End: Complemental strand, 32084665 - 32084450
Alignment:
| Q |
2 |
gatgatgctggtggcgaagagggggaagaaagaagtggtgatggatttgatggcttcttttagtttgaccggtcgatcaaagaaggcgtggaagacgctg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32084665 |
gatgatgctggtggcgaagagggggaagaaagaagtggtgatggatttgatggcttcttttagtttgaccggtcgatcaaagaaggcgtggaagacgctg |
32084566 |
T |
|
| Q |
102 |
taggtgacggtgatgacggcgccataactgaagatggaagagataagtaagaagatgattgataaaaaggtgattgtgctgtggttgctgggtggttgct |
201 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32084565 |
taggtgatggtgatgacggcgccataactgaagatggaagagataagtaagaagatgatagataaaaaggtgattgtgctgtggtttctgggtggttgct |
32084466 |
T |
|
| Q |
202 |
gttgaaggtgtttgaa |
217 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
32084465 |
gttgaaggtgtttgaa |
32084450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 11 - 125
Target Start/End: Complemental strand, 32080071 - 32079957
Alignment:
| Q |
11 |
ggtggcgaagagggggaagaaagaagtggtgatggatttgatggcttcttttagtttgaccggtcgatcaaagaaggcgtggaagacgctgtaggtgacg |
110 |
Q |
| |
|
|||||||| |||||||||||| |||||| |||||||||||| ||||||||| |||||||| ||||| | |||| | |||||||||||||||||||||| | |
|
|
| T |
32080071 |
ggtggcgaggagggggaagaaggaagtgatgatggatttgagggcttctttgagtttgactggtcggttaaagcaagcgtggaagacgctgtaggtgatg |
32079972 |
T |
|
| Q |
111 |
gtgatgacggcgcca |
125 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
32079971 |
gtgatgacggcgcca |
32079957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 11 - 123
Target Start/End: Complemental strand, 32087207 - 32087095
Alignment:
| Q |
11 |
ggtggcgaagagggggaagaaagaagtggtgatggatttgatggcttcttttagtttgaccggtcgatcaaagaaggcgtggaagacgctgtaggtgacg |
110 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||||||||||| |||||||| ||| ||| ||||||||||| | | ||||| || |||| | |
|
|
| T |
32087207 |
ggtggcaaggagggggaagaaagaagtggtgatggatttgatggcttctttgagtttgacgggttgattaaagaaggcgttgtatacgctataagtgatg |
32087108 |
T |
|
| Q |
111 |
gtgatgacggcgc |
123 |
Q |
| |
|
| ||||| ||||| |
|
|
| T |
32087107 |
gcgatgaaggcgc |
32087095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 196 - 260
Target Start/End: Complemental strand, 32087031 - 32086967
Alignment:
| Q |
196 |
gttgctgttgaaggtgtttgaaaatgagtttgaagatgtgggagaggaaagagaggggaaggagg |
260 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||| || ||| ||||||| |||||||||| |
|
|
| T |
32087031 |
gttgctgttgaaggtgtttgataatgagtttagagatgaggatgagaaaagagaagggaaggagg |
32086967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University