View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7528_low_7 (Length: 263)
Name: NF7528_low_7
Description: NF7528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7528_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 24 - 192
Target Start/End: Complemental strand, 3807149 - 3806981
Alignment:
| Q |
24 |
ttctatttcttcaatagcttctttggtggcactccttatctttgtctccaaagaacttgtgttatctatattggtctacaccaaaatcaaatgattttgg |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3807149 |
ttctatttcttcaatagcttctttggtggcactccttatcttagtctccaaagaacttgtgttatctatattggtctaaaccaaaatcaaatgattttgg |
3807050 |
T |
 |
| Q |
124 |
aacaaaagcaaatttaaatcatatttattaataaacaaatatagcatttattcaagtcgtgtttttatt |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3807049 |
aacaaaagcaaatttaaatcatatttattaataaacaaatatagcatttatccaagtcgtgtttttatt |
3806981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 27 - 115
Target Start/End: Complemental strand, 3775189 - 3775101
Alignment:
| Q |
27 |
tatttcttcaatagcttctttggtggcactccttatctttgtctccaaagaacttgtgttatctatattggtctacaccaaaatcaaat |
115 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| | | ||||||||||| ||||||||| |||| |
|
|
| T |
3775189 |
tatttcttgaatagcttctttagtggcactccttatctttgtctccaaagaacttgttctgtatatattggtctgcaccaaaattaaat |
3775101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 185 - 237
Target Start/End: Complemental strand, 3806967 - 3806915
Alignment:
| Q |
185 |
tttttatttttgctgataagtattgaaattaatttaaaaatataacacacaca |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3806967 |
tttttatttttgctgataagtattgaaattaatttaaaaataacacacacaca |
3806915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 104 - 152
Target Start/End: Complemental strand, 3775072 - 3775024
Alignment:
| Q |
104 |
ccaaaatcaaatgattttggaacaaaagcaaatttaaatcatatttatt |
152 |
Q |
| |
|
|||||||| |||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
3775072 |
ccaaaatctaatgcttttggaacaaaagaaaatttaaatcatatttatt |
3775024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University