View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7529_high_2 (Length: 250)
Name: NF7529_high_2
Description: NF7529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7529_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 47575819 - 47575932
Alignment:
| Q |
1 |
aacactttaacttccccattggtttacaaatgcatctttcttgcggaataaaatgcagacaaaattatcatctatctttaactcaagtgcagaaaactct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47575819 |
aacactttaacttccccattggtttacaaatgcatctttcttgcggaataaaatgcagacaaaattatcatctatctttaactcaagtgcagaaaactct |
47575918 |
T |
|
| Q |
101 |
gttgtcgttcaaat |
114 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
47575919 |
gttgtcgttcaaat |
47575932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 114 - 239
Target Start/End: Original strand, 47576143 - 47576268
Alignment:
| Q |
114 |
taaaatcaccgaattttatgtttttaggttttaaattggtttgggtgaaatcgaattcaaagcgatttcacatcaaattaaaatagggtaaaatcgagta |
213 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47576143 |
taaaatcacataattttatgtttttaggttttaaattggtttgggtgaaatcgaattcaaagcaatttcacatcaaattaaaatagggtaaaatcgagta |
47576242 |
T |
|
| Q |
214 |
taatcaattgaaatcaacttgatatt |
239 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
47576243 |
taatcaattgaaatcaacttgatatt |
47576268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University