View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7530_low_4 (Length: 300)
Name: NF7530_low_4
Description: NF7530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7530_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 18 - 292
Target Start/End: Original strand, 47128125 - 47128399
Alignment:
| Q |
18 |
gtaagcccatctaaactattttctatgtgctttgcttggatgtaactgttttggtctccataaacacttgggtccagcttgctggcaggaggaaattcct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47128125 |
gtaagcccatctaaactattttctatgtgctttgcttggatggaactgttttggtctccataaacacttgggtccagcttgctggcaggaggaaattcct |
47128224 |
T |
|
| Q |
118 |
atatgtacaagaaacattgaaacatattannnnnnnataacaaggataagttttttaattaaaattgtaaactctgaactaaaatataagcagaaaatgt |
217 |
Q |
| |
|
| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47128225 |
acatgtacaagaaacattgaaacatattatttttttataacaaggataagttttttaattaaaattgtaaactctgaactaaaatataagcagaaaatgt |
47128324 |
T |
|
| Q |
218 |
agatgtgcttggtcgaaattcagacaagtacatataaacttttttacgtatatttaagtccagagggagtattat |
292 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47128325 |
agatgtacttggtcgaaattcggacaagtacatataaacttttttacgtatatttaagtccagagggagtattat |
47128399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University