View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7532_high_2 (Length: 528)
Name: NF7532_high_2
Description: NF7532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7532_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 4e-76; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 4e-76
Query Start/End: Original strand, 312 - 456
Target Start/End: Original strand, 6649316 - 6649460
Alignment:
| Q |
312 |
cgatcaaacgaatatttcgattttgagtttgtcactgatggatctaacaacttccattctccgccgaaaccctacgattcgttttttcgtcttttcaaac |
411 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6649316 |
cgatcaaacgaatatttcgattttgagtttgtcactgatggatctaacaacttccattctccgccgaaaccctacgattcgttttttcgtcttttcaaac |
6649415 |
T |
 |
| Q |
412 |
ttcacttgcacgcaaactacgtcattttcagatctatcggtgcaa |
456 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6649416 |
ttcacttgcacgcaaactacgtcattttcagatctatcggtgcaa |
6649460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 19 - 96
Target Start/End: Original strand, 6649025 - 6649102
Alignment:
| Q |
19 |
aagaaaaaggaaattaagtattggctggtccatgaaaggtgtttttgcttgctcttgtggcagtgtactcaagaaact |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6649025 |
aagaaaaaggaaattaagtattggctggtccatgaaaggtgtttttgcttgctcttgtggcagtgtactcaagaaact |
6649102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 6649195 - 6649255
Alignment:
| Q |
191 |
aacaaatcacatgctgtgaaaatttctttctgatgccgattctttcacacctcactgtaag |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6649195 |
aacaaatcacatgctgtgaaaatttctttctgatgccgattctttcacacctcactgtaag |
6649255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University