View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7533_high_2 (Length: 305)
Name: NF7533_high_2
Description: NF7533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7533_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 15 - 287
Target Start/End: Original strand, 16352935 - 16353207
Alignment:
| Q |
15 |
aagaatatccgtttggttcatctaagtggctatgtagaggattttgagcaaccaatttcagttaaccaagtgatcaatagtagaaatccaccaactcact |
114 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16352935 |
aagaaaatccgtttggttcatctaagtggctatgtagaggattttgagcaaccaatttcagttaaccaagtgatcaatagtagaaatccaccaactcact |
16353034 |
T |
 |
| Q |
115 |
ttgtttgtacctcccttcaacttctttcatcttcttcaaaaccattgaaaggagatacacaacttcaaccaggaaatgtttacttcatgctaccttattc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16353035 |
ttgtttgtacctcccttcaacttctttcatcttcttcaaaaccattgaaaggagatacacaacttcaaccaggaaatgtttacttcatgctaccttattc |
16353134 |
T |
 |
| Q |
215 |
aattctacaagccgatgtttcgcctgtggatttggcttcgcttgcgaaaaggctcactgcaaaggcgaaaact |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16353135 |
aattctacaagccgatgtttcgcctgtggatttggcttcgcttgcgaaaaggctcactgcaaaggcgaaaact |
16353207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University