View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7533_low_1 (Length: 321)
Name: NF7533_low_1
Description: NF7533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7533_low_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 62 - 306
Target Start/End: Original strand, 9458329 - 9458573
Alignment:
| Q |
62 |
ttttcgcaattcctctttcagttccttttggattttgtttatgttcttgcgaatgtgattacgattttcagtaatttggccatagtattttcccaaaatc |
161 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9458329 |
ttttcacaattcctctttcaattccttttggattttgtttatgttcttgcgaatgtgattacgagtttcagtaatttggccatagtattttctcaaaatc |
9458428 |
T |
 |
| Q |
162 |
cttgattttgtgatttcaattagattgcatttcagtctatcaaatcattcttttcttattctgatctagtttcggttctagttctacgagtcatttccat |
261 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9458429 |
ctttattttgtgatttcaattagattgcatttcagtctattaaatcattcttttcttattctgatctagtttcggttctagttctacgagtcaattccat |
9458528 |
T |
 |
| Q |
262 |
ttcaatcttattcgttttcctttatcatgatcaagtttaaatctg |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9458529 |
ttcaatcttattcgttttcctttatcatgatcaagtttaaatctg |
9458573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 66
Target Start/End: Original strand, 9457253 - 9457309
Alignment:
| Q |
10 |
gtgttttgtgtaggggagagataaaatgtttataaattacaattaatcttgattttc |
66 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9457253 |
gtgttttgcgtaggggagagataaaatgtttataaattacaattaatcttgattttc |
9457309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University