View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7533_low_7 (Length: 224)
Name: NF7533_low_7
Description: NF7533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7533_low_7 |
 | |
|
| [»] scaffold0070 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 5e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 35004019 - 35004131
Alignment:
| Q |
1 |
ctatcaataccatcctccgttgttttgagcttgccttgggtctcagggttaattttgctaaaagttgtttaatggggatccatgtggaagattctttctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35004019 |
ctatcaataccatcctccgttgttttgagcttgccttgggtctcagtgttaattttgctaaaagttgtttaatggggatccatgtggaagattctttctt |
35004118 |
T |
|
| Q |
101 |
gaggatggcggaa |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
35004119 |
gaggatggcggaa |
35004131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 112 - 212
Target Start/End: Original strand, 35004228 - 35004328
Alignment:
| Q |
112 |
aacgttgtctccactgtatgcttagtagtcttcccttcaaataccttgggttagcggtgggggctaatcctcgttctgccagaacctgggaacctttagt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35004228 |
aacgttgtctccactgtatgcttagtagtcttcccttcaaataccttgggttagcggtgggggctaatcctcgttctgccagaacctgggaacctttagt |
35004327 |
T |
|
| Q |
212 |
c |
212 |
Q |
| |
|
| |
|
|
| T |
35004328 |
c |
35004328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0070 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0070
Description:
Target: scaffold0070; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 12 - 93
Target Start/End: Complemental strand, 43563 - 43483
Alignment:
| Q |
12 |
atcctccgttgttttgagcttgccttgggtctcagggttaattttgctaaaagttgtttaatggggatccatgtggaagatt |
93 |
Q |
| |
|
|||||||||||||||||| |||||| ||| ||||| ||||||||||||| |||||| || |||| | ||||||||| |||| |
|
|
| T |
43563 |
atcctccgttgttttgagtttgcctcgggcttcagg-ttaattttgctaagagttgtctagtgggaacccatgtggatgatt |
43483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University