View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7536_high_1 (Length: 250)
Name: NF7536_high_1
Description: NF7536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7536_high_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 19 - 228
Target Start/End: Complemental strand, 29200003 - 29199794
Alignment:
| Q |
19 |
tctttaggatgtgaaactctagatctaaatttagcgacattgttgacaacatcttttatagggaaagatggagcaccagcagaagaagaatgacgaagag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29200003 |
tctttaggatgtgaaactctagatctaaatttagcgacattgttgacaacatcttttatagggaaagatggagcaccagcagaagaagaatgacgaagag |
29199904 |
T |
|
| Q |
119 |
gcgaagagaatcgcgttcgaatttgattaagacctaacgacgaagcttgcaaaatggaagaagaataagaacattcagcacgttcgaattcacgttcagt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29199903 |
gcgaagagaatcgcgttcgaatttgattaagacctaacgacgaagcttgcaaaatggaagaagaataagaacattcagcacgttcgaattcacgttcagt |
29199804 |
T |
|
| Q |
219 |
tacaagaacg |
228 |
Q |
| |
|
|||||||||| |
|
|
| T |
29199803 |
tacaagaacg |
29199794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 19 - 228
Target Start/End: Original strand, 12651888 - 12652097
Alignment:
| Q |
19 |
tctttaggatgtgaaactctagatctaaatttagcgacattgttgacaacatcttttatagggaaagatggagcaccagcagaagaagaatgacgaagag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12651888 |
tctttaggatgtgaaactctagatctaaatttagcgacattgttgacaacatcttttatagggaaagatggagcaccagcagaagaagaatgacgaagag |
12651987 |
T |
|
| Q |
119 |
gcgaagagaatcgcgttcgaatttgattaagacctaacgacgaagcttgcaaaatggaagaagaataagaacattcagcacgttcgaattcacgttcagt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12651988 |
gcgaagagaatcgcgttcgaatttgattaagacctaacgacgaagcttgcaaaatggaagaagaataagaacattcagcacgttcgaattcactttcagt |
12652087 |
T |
|
| Q |
219 |
tacaagaacg |
228 |
Q |
| |
|
||| |||||| |
|
|
| T |
12652088 |
tacgagaacg |
12652097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University