View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7539_high_13 (Length: 298)
Name: NF7539_high_13
Description: NF7539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7539_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 17 - 279
Target Start/End: Complemental strand, 34062636 - 34062372
Alignment:
| Q |
17 |
ttgagcgtgagttgactcattcagaatt--gagaataaacaattttgatagggagaaaaacaaagttctaacgaatgcctaagagaaaaaagtttggaaa |
114 |
Q |
| |
|
||||||||||||| |||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
34062636 |
ttgagcgtgagttaactcatacagaattaagagaataaacaattttgatagggagaaaaacaaagttctaacgaatgcctaagagaaaaaagtttgaaaa |
34062537 |
T |
 |
| Q |
115 |
accacatatgaaaacattcttttgattctcaatactatctttgttatgggatgaaatttatgtagctttgaccactttgataacaagtctcccaaaaaat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34062536 |
accacatatgaaaacattcttttgattctcaatactatctttgttatgggatgaaatttatgtagctttgaccactttgataacaagtctcccataaaat |
34062437 |
T |
 |
| Q |
215 |
gttacatgcatagaaatttctctagaaaatagagtgttagcatatttcaaacatcatactgatgt |
279 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
34062436 |
ggtacatgcatagaaatttctctagaaaatagagtgttagcacatttcaaacatcataccgatgt |
34062372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University