View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7539_high_20 (Length: 241)
Name: NF7539_high_20
Description: NF7539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7539_high_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 10 - 225
Target Start/End: Original strand, 4474652 - 4474862
Alignment:
| Q |
10 |
gaaggaagaaaaatatgagtttaatttgctaagatgttttgtgaggggaatatggaatttggttgagctagctatagagattatagttggctcaaagatg |
109 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4474652 |
gaaggaagaaaaatatgagttt-----gctaagatgttttgtgaggggaatatggaatttggttgagctagctatagagattatagttggctcaaagatg |
4474746 |
T |
|
| Q |
110 |
ttatgatnnnnnnnnnnnnnnnggtgtaggggtttttaaaggacgaaagaagggtatggtaatgttggtgaacaattttgagaaagaaaatttataattc |
209 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4474747 |
ttatgatgagagagagagagagggtgtaggggtttttaaaggacgaaagaagggtatggtaatgttggtgaacaattttgagaaagaaaatttataattc |
4474846 |
T |
|
| Q |
210 |
aatgtaataaaataat |
225 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
4474847 |
aatgtaataaaataat |
4474862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University