View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7539_high_26 (Length: 209)
Name: NF7539_high_26
Description: NF7539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7539_high_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 11 - 190
Target Start/End: Original strand, 23518138 - 23518317
Alignment:
| Q |
11 |
ttggtggtggtgatttgcgatgacataatattcaacaatttcctcgcgacgtcttggaacatgaatacggtcattattgaatggattggtgttagtcaag |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23518138 |
ttggtggtggtgatttgcgatgacataatattcaacaatttcctcgcgacgtcttggaacatgaatacggtcattattgaatggagtggtgttagtcaag |
23518237 |
T |
|
| Q |
111 |
atcacaacaatgacagtaaatagagtagtagtgaataggagtggagagaagaatattatcaatgtaatgatggcagggag |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23518238 |
atcacaacaatgacagtaaatagagtagtagtgaaaaggagtggagagaagaatattatcaatgtaatgatggcagggag |
23518317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University