View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7539_low_21 (Length: 249)
Name: NF7539_low_21
Description: NF7539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7539_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 8 - 231
Target Start/End: Original strand, 13471059 - 13471276
Alignment:
| Q |
8 |
atttgtgtgacaaatgtaagcagtagagtagagtgtagcataggagcatggggcagagaaagtatcaagttaagagaggttaaatgaaagagttaggatt |
107 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13471059 |
atttgtgtgaaaaatgtaagcagtagagtagagtatagaataggagcatggggcagagaaagtatcaagttaagagaggttaaatgagagagttaggatt |
13471158 |
T |
 |
| Q |
108 |
gtaggaactattccataatagagatagagacagagcagagagggtagcatgcatgcatgcttatcgattttcaccaccatatcctttggaagattattat |
207 |
Q |
| |
|
| ||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13471159 |
ggaggaactattccata------atagagacagagcagagatggtagcatgcatgcatgcttatcgattttcaccaccatatcctttggaagattattat |
13471252 |
T |
 |
| Q |
208 |
ttatatgaaattatgtatcaaaaa |
231 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
13471253 |
ttatatgaaattatgtatcaaaaa |
13471276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University