View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7539_low_22 (Length: 249)
Name: NF7539_low_22
Description: NF7539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7539_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 13 - 242
Target Start/End: Complemental strand, 4474644 - 4474415
Alignment:
| Q |
13 |
tttcctccctttgtcatgggagcctttccacttttcccaccaatttccaaatgtagcacaaaagatagatcaaaccaaacagtggcatccgacttagacg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4474644 |
tttcctccctttgtcatgggagcctttccacttttcccaccaatttccaaatgtagcacaaaagatagatcaaaccaaaccgtggcatccgacttagacg |
4474545 |
T |
|
| Q |
113 |
gcacccttctcgtgtcgcgaagtgcatttccatactacatgctcgtcgcactcgaagctggaagcattctaagagctttaattctcttatccttagtccc |
212 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4474544 |
gcacccttctcatgtcgcgaagtgcatttccatactacatgctcgtcgcactcgaagctggaagcattctaagagctttaattctcttatccttagtccc |
4474445 |
T |
|
| Q |
213 |
tttcgtatattttacatacctattcttctc |
242 |
Q |
| |
|
|||||||||||| || ||||||||| |||| |
|
|
| T |
4474444 |
tttcgtatatttcacgtacctattcgtctc |
4474415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University