View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7541_low_2 (Length: 307)
Name: NF7541_low_2
Description: NF7541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7541_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 16 - 299
Target Start/End: Complemental strand, 29556440 - 29556157
Alignment:
| Q |
16 |
aattagaaccacaaatttgtgttgatgatgaaaagcatttgtcacaaccaaaatcattattctcttcttcaacaatggtatccaacattttcttcattgg |
115 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29556440 |
aattagagccacaaatttgtgttgatgatgaaaagcatttgtcacaaccaaaatcattattctcttcttcaacaatggtatccaacattttcttcattgg |
29556341 |
T |
|
| Q |
116 |
aatccttgtcacagacacaaacctcggtggagcaacctcggtggtgattaattttgcaatttgcttcaacttgttggccatttcaagaaattctagtgtt |
215 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29556340 |
aatccttgtcacggacacaaaccttggtggagcagcctcggtggtgattaattttgcaatttgcttcaacttgttggccattttaagaaattctagtgtt |
29556241 |
T |
|
| Q |
216 |
gttggcataaacaagtgatgaacatgtgaagaaaaaggagacataagataaaaacaagagtagtagtgtgttaatatattcttc |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || |||||||| |
|
|
| T |
29556240 |
gttggcataaacaagtgatgaacatgtgaagaaaaaggagacataagataaaaagaagagtagtagtgtgttgatctattcttc |
29556157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University