View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7543_low_3 (Length: 226)
Name: NF7543_low_3
Description: NF7543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7543_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 94 - 211
Target Start/End: Original strand, 33022341 - 33022458
Alignment:
| Q |
94 |
ttaataaatggacaaatcaatttgtgaacttttttgaggttgtggagacgatttcatgactagttcattatttcagtttactctatggttgaaatttgaa |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33022341 |
ttaataaatggacaaatcaatttgtgaacttttttgaggttgtggagacgatttcatgactagttcattatttcagtttactctatggttgaaatttgaa |
33022440 |
T |
 |
| Q |
194 |
acatcgttataacttctt |
211 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
33022441 |
acatcgttataacttctt |
33022458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 18 - 69
Target Start/End: Original strand, 33022293 - 33022343
Alignment:
| Q |
18 |
gttttcaaaagattcaactctaggtgcttttgagctcacactcacagtttta |
69 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
33022293 |
gttttcaaaagattcaactct-ggtgcttttcagctcacactcacagtttta |
33022343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University