View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7543_low_4 (Length: 224)
Name: NF7543_low_4
Description: NF7543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7543_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 71 - 209
Target Start/End: Complemental strand, 53639864 - 53639727
Alignment:
| Q |
71 |
agctattacattgaatcacaaaagagtgtgtgtgatgtctaaaaagtttaacctctattgccacccaattcctgattcatttagatttataatttattca |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
53639864 |
agctattacattgaatcacaaaagagtgtgtgtgatgtctaaaaagtttaacctctattgccacccaat-cctgattcatttagatttataatttattca |
53639766 |
T |
|
| Q |
171 |
cacttttaattaaacagaaaagcaaaggatattttgtat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53639765 |
cacttttaattaaacagaaaagcaaaggatattttgtat |
53639727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University