View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7546_low_11 (Length: 239)
Name: NF7546_low_11
Description: NF7546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7546_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 14 - 236
Target Start/End: Complemental strand, 15632455 - 15632233
Alignment:
| Q |
14 |
catatatatcaccttgctaatcaaatacaccaatttctccgaattgtttcacactttaggggtacgtatatcacttctatgatcataggtttcagaagtt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
15632455 |
catatatatcaccttgctaatcaaatacaccaatttctccgaattgtttcacactttaggggtacgtatatcagttctatgatcataggtttcagaagtt |
15632356 |
T |
 |
| Q |
114 |
ccattgttgcattattctttattttttgtgaactaatggtgttattttctttgtttttgtcgtcctagtcgttggccaaagaattgataactcctagtgg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
15632355 |
ccattgttgcattattctttattttttgtgaactaatgctgttattttctttgtttttgtcgtcctagttgttggccaaagaattgataactcctagtgg |
15632256 |
T |
 |
| Q |
214 |
ccctgttcaggtaacaccaaact |
236 |
Q |
| |
|
|||||||||||||||| |||||| |
|
|
| T |
15632255 |
ccctgttcaggtaacaacaaact |
15632233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University