View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7546_low_12 (Length: 211)
Name: NF7546_low_12
Description: NF7546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7546_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 36416906 - 36417108
Alignment:
| Q |
1 |
ttggttggttggttacacacatttcactgcctgtgtcagtgtgnnnnnnnn-cttgtttattttgagcaatactttgactagacgcaagaaggaacgtgg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36416906 |
ttggttggttggttacacacatttcactgcctgtgtcagtgtgtttttttttcttgtttattttgagcaatactttgactagacgcaagaaggaacgtgg |
36417005 |
T |
 |
| Q |
100 |
ttggtccatcctttcttctgcatttatttcaaac--aagaatttctttatttatccaaaacaaggctggcatacgctaggggggaacgtgcttggttctt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36417006 |
ttggtccatcctttcttctgcatttatttcaaacaaaagaaattctttatttatccaaaacaaggctggcatacgctaggggggaacgtgcttggttctt |
36417105 |
T |
 |
| Q |
198 |
cat |
200 |
Q |
| |
|
||| |
|
|
| T |
36417106 |
cat |
36417108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University