View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7547_high_16 (Length: 340)
Name: NF7547_high_16
Description: NF7547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7547_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 7e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 45 - 228
Target Start/End: Complemental strand, 5113366 - 5113186
Alignment:
| Q |
45 |
aatggaaaactatgcattgcacaaaaaggaagaaagataatatttattcttgccttcgtataggcaggaacttgtccgccaagataaatttgcggtaaaa |
144 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5113366 |
aatggaaaactatgcattgcacgaaaaggaagaaagataatatttattcatgccttcgtataggcaggaacttgtccgccaagataaatttgcggtaaaa |
5113267 |
T |
 |
| Q |
145 |
ctctgcatcaagctctttaattcttttccttatcaaaaccagaaagcctcttgtcattcaggaataatcaaacccctaccagtg |
228 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5113266 |
ctctgcatcaagctctttaattcttt---aattcaaaaccagaaatcctcttgtcattcaggaataatcaaacccctaccagtg |
5113186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 247 - 321
Target Start/End: Complemental strand, 5113196 - 5113122
Alignment:
| Q |
247 |
ccctaccagtgctccctgaaaaccatcacaattattcaaatcaaccattnnnnnnnccaacaatatgtattgcga |
321 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5113196 |
ccctaccagtgctccctgaaaatcatcacaattattcaaatcaaccattaaaaaaaccaacaatatgtattgcga |
5113122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University