View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7547_high_24 (Length: 235)

Name: NF7547_high_24
Description: NF7547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7547_high_24
NF7547_high_24
[»] chr4 (1 HSPs)
chr4 (25-222)||(2280553-2280750)


Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 25 - 222
Target Start/End: Original strand, 2280553 - 2280750
Alignment:
25 ttgtgcagttctattaaggtatatttttgtttatgcgttgtaagggagcaagtacgaaactactctttgacaagaagattgggaagacaaatggagcaaa 124  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
2280553 ttgtgcagttctattaaggtatatttttgtttatgcgttgtaagggagcaagtacgaaactactctttgacaagaagattgggaagacaaatagagcaaa 2280652  T
125 tcaaaaggaatgactgattgactaagctagatgaagaatttattagttaaacccatattcattcattcattttttgatgaatccggcatggaggaagt 222  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
2280653 tcaaaaggaatgactgattgactaagttagatgaagaatttattagttaaacccatattcattcattcattttttgatgaattcggcatggaggaagt 2280750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University