View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7547_low_22 (Length: 244)
Name: NF7547_low_22
Description: NF7547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7547_low_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 31912067 - 31912292
Alignment:
| Q |
1 |
ttgatgatttttctttatctgctttggtatcgggttatgcaaatgccggtagaatgagtgatgcaagaaaggtttttgataacaaggttgatccttgttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31912067 |
ttgatgatttttctttatctgctttggtatcgggttatgcaaatgccggtagaatgagtgatgcaagaaaggtttttgataacaaggttgatccttgttc |
31912166 |
T |
|
| Q |
101 |
tgtgctgtggaattcgattatttctggttacgtgtccaatggtgaggaaatggaagcattggctctattcaacaaaatgcgtaggaatggggtttgggga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31912167 |
tgtgctgtggaattcgattatttctggttacgtgtccaatggtgaggaaatggaagcattggctctattcaacaaaatgcgtaggaatggggtttgggga |
31912266 |
T |
|
| Q |
201 |
gatttctctgctgttgcaaacatttt |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
31912267 |
gatttctctgctgttgcaaacatttt |
31912292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 40651382 - 40651607
Alignment:
| Q |
1 |
ttgatgatttttctttatctgctttggtatcgggttatgcaaatgccggtagaatgagtgatgcaagaaaggtttttgataacaaggttgatccttgttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
40651382 |
ttgatgatttttctttatctgctttggtatcgggttatgcaaatgctggtagaatgagtgatgcgagaagggtttttgataacaaggttgatccttgttc |
40651481 |
T |
|
| Q |
101 |
tgtgctgtggaattcgattatttctggttacgtgtccaatggtgaggaaatggaagcattggctctattcaacaaaatgcgtaggaatggggtttgggga |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| | |||||||| |||||||||||| ||| ||| ||||| |
|
|
| T |
40651482 |
tgtgctgtggaattcgattatttcaggttatgtgtccaatggtgaggaaatggaagcattggatttattcaaccaaatgcgtaggagtggagttagggga |
40651581 |
T |
|
| Q |
201 |
gatttctctgctgttgcaaacatttt |
226 |
Q |
| |
|
|| ||| |||| |||||||||||||| |
|
|
| T |
40651582 |
gaattccctgccgttgcaaacatttt |
40651607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University