View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7547_low_24 (Length: 235)
Name: NF7547_low_24
Description: NF7547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7547_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 25 - 222
Target Start/End: Original strand, 2280553 - 2280750
Alignment:
| Q |
25 |
ttgtgcagttctattaaggtatatttttgtttatgcgttgtaagggagcaagtacgaaactactctttgacaagaagattgggaagacaaatggagcaaa |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2280553 |
ttgtgcagttctattaaggtatatttttgtttatgcgttgtaagggagcaagtacgaaactactctttgacaagaagattgggaagacaaatagagcaaa |
2280652 |
T |
|
| Q |
125 |
tcaaaaggaatgactgattgactaagctagatgaagaatttattagttaaacccatattcattcattcattttttgatgaatccggcatggaggaagt |
222 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2280653 |
tcaaaaggaatgactgattgactaagttagatgaagaatttattagttaaacccatattcattcattcattttttgatgaattcggcatggaggaagt |
2280750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University