View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7547_low_25 (Length: 219)
Name: NF7547_low_25
Description: NF7547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7547_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 91; Significance: 3e-44; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 18 - 116
Target Start/End: Original strand, 26053688 - 26053786
Alignment:
| Q |
18 |
tcttgtatcgttcccctaaactttgagtcagtcactatgctccagtatactccactgaatacataggttatacatcacatgcttcttctttcccggtta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
26053688 |
tcttgtatcgttcccctaaactttgagtcagtcactatgctccagtatactccactgaatacataggttatacattacatgcttcttctttcccagtta |
26053786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 165 - 210
Target Start/End: Original strand, 26053820 - 26053865
Alignment:
| Q |
165 |
cttaaagaaatttatgcaattttgtcatttgattgtaatattcttc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26053820 |
cttaaagaaatttatgcaattttgtcatttgattgtaattttcttc |
26053865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 44 - 75
Target Start/End: Original strand, 26023584 - 26023615
Alignment:
| Q |
44 |
gtcagtcactatgctccagtatactccactga |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
26023584 |
gtcagtcactatgctccagtatactccactga |
26023615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University