View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7548_high_3 (Length: 259)
Name: NF7548_high_3
Description: NF7548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7548_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 18 - 253
Target Start/End: Complemental strand, 39724935 - 39724700
Alignment:
| Q |
18 |
atagtaatgggagtgctatcaggaagtgtgccatggtacacaatgatggtacttggaaagaagatatcaatatttcaaaaggttgatgacaccctcgccg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39724935 |
atagtaatgggagtgctatcaggaagtgtgccatggtacacaatgatggtacttggaaagaagatatcaatatttcaaaaggttgatgacaccctcgccg |
39724836 |
T |
 |
| Q |
118 |
tgttccacactcatgccgtggctggcctactaggcggtgtactcaccggcctattcgccgagccacaattaagtactctctttctccccgtcaccaattc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39724835 |
tgttccacactcatgccgtggctggcctactaggcggtgtactcaccggcctattcgccgagccacaattaagtactctctttctccccgtcaccaattc |
39724736 |
T |
 |
| Q |
218 |
caaaggaggtgtctatggaggctctgatgatgtcca |
253 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||| |
|
|
| T |
39724735 |
caaaggaggtgtctatggaggctctggtggtgtcca |
39724700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University