View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7549_high_3 (Length: 259)
Name: NF7549_high_3
Description: NF7549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7549_high_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 30128477 - 30128717
Alignment:
| Q |
1 |
actgtcttgttttgtggccttcacggggttctggtttcggctacaacatgctgtgtttgtctgttttgcttactatgggtttcgggnnnnnnnnnnnn-g |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
30128477 |
actgtcttgttttgtggccttcacggggttctggtttcggctacaacatgctgtgtttgtctgttttgcttactatgggtttcgggttgttttttttttg |
30128576 |
T |
|
| Q |
100 |
tatcgatgttttgccagtttcagcatcccagtagtggttgttttttgctgtgtttctcttcgggtattccgtctatataccacatccgatgttttgtatt |
199 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30128577 |
tatcgatgttttggtagtttcagcatcctagtagtggttgttttttgctgtgtttctcttcgggtattccgtctatataccacatccgatgttttgtatt |
30128676 |
T |
|
| Q |
200 |
tccctgtgtggcaagattggtgcatctcgtgcaggttttgc |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30128677 |
tccctgtgtggcaagattggtgcatctcgtgcaggttttgc |
30128717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University