View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7549_low_2 (Length: 325)
Name: NF7549_low_2
Description: NF7549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7549_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 19 - 313
Target Start/End: Original strand, 2467778 - 2468063
Alignment:
| Q |
19 |
tcttccattttcccccctcctactcctcgctgcaatctcaaattaccaccacgctttcaattcaccaacatttttcgggctacaacggtaatttcctgaa |
118 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2467778 |
tcttccatttttccccctcctactcctcgctgcaatctcaaattaccaccacgctttcaattcaccaacatttttcggtctacaacggtaatttcctgaa |
2467877 |
T |
 |
| Q |
119 |
cctatcttcaacttcatttcattcaattcaatgcctcaaatttattttcattttcgtatagggattcgttcgtgcttccgaggatgactctgttgccgaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2467878 |
cctatcttcaacttcatttcattcaattcaatgcctcaaatttattttcattttcgtatagggattcgttcgtgcttccgaggatgactctgttgccgaa |
2467977 |
T |
 |
| Q |
219 |
aattccgattctcaatgccaattggcaacacagaatgtgtcttctgatgataatgatgatgcatccatgacagttttgaagtttatgctgttctc |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2467978 |
aattccgattctcaatgccaattggcaacacagaatgtgtcttc---------tgatgatgcatccatgacagttttgaagtttatgctgttctc |
2468063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University