View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7550_high_28 (Length: 437)
Name: NF7550_high_28
Description: NF7550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7550_high_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 4e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 4e-85
Query Start/End: Original strand, 231 - 418
Target Start/End: Original strand, 39318289 - 39318476
Alignment:
| Q |
231 |
caaatagcttgacaggcacatgaagttcctgctacaaactcagcttttatggtggatatagtgtcagtaggttgtttattatatgatcatgacactaacc |
330 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| | ||||||||| ||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
39318289 |
caaatagcttgacagacacatgaagttcctgctacaaactcagcttctgtggtggatagagtgtcaataggttttttattatatgatcatgacactaacc |
39318388 |
T |
 |
| Q |
331 |
ctgaacccagcacgaacacatatattgatgtgcttttatatcatccacattgcctgcataatcataatcataccatccttataactcc |
418 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39318389 |
ctgaacccagcacgaacacatatattgatgtgcttttatatcatccacatcgcctgcataatcataatcataccatccttataactcc |
39318476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University