View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7550_high_30 (Length: 427)
Name: NF7550_high_30
Description: NF7550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7550_high_30 |
 |  |
|
| [»] scaffold0438 (1 HSPs) |
 |  |  |
|
| [»] scaffold0391 (1 HSPs) |
 |  |  |
|
| [»] scaffold0276 (2 HSPs) |
 |  |  |
|
| [»] scaffold0368 (1 HSPs) |
 |  |  |
|
| [»] scaffold0065 (1 HSPs) |
 |  |  |
|
| [»] scaffold0248 (1 HSPs) |
 |  |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 299; Significance: 1e-168; HSPs: 33)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 13 - 350
Target Start/End: Complemental strand, 45202839 - 45202491
Alignment:
| Q |
13 |
aatatgactgtcacaaatgaaatgcaactatagaatgactcattgtcacatttatctatctattctaagaaaaatctttgataatgacatatggtagaat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45202839 |
aatatgactgtcacaaatgaaatgcaactatagaatgactcattgtcacatttatctatctattctaagaaaaatctttgataatgacatatggtagaat |
45202740 |
T |
 |
| Q |
113 |
tttatacctctattttctgtcatattttcccctctgcatgggatccttactagttttctttaatgagactgagccctacatttatacacataagttttga |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45202739 |
tttatacctctattttctgtcatattttcccctctgcatgggatccttactagttttctttaatgagactgagccttacatttatacacataagttttga |
45202640 |
T |
 |
| Q |
213 |
gcttatagtgaatggttggggttcattttttgtgaaaggtataagtgattttaaacaattaaaatttattttggttatttgttgggtgttt--------- |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45202639 |
gcttatagtgaatggttggggttcattttttgtgaaaggtataagtgattttaaacaattaaaatttattttggttatttgttgggtgtttgagagttgt |
45202540 |
T |
 |
| Q |
304 |
--gagaattttgggctaaaattagttttacctccaaaatattattctaa |
350 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45202539 |
ttgagagttttgggctaaaattatttttacctccaaaatattattctaa |
45202491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 6653250 - 6653295
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6653250 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
6653295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 11173558 - 11173513
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11173558 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
11173513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 13240277 - 13240232
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13240277 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
13240232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 14247503 - 14247458
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14247503 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
14247458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 24317207 - 24317252
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24317207 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
24317252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 33010844 - 33010799
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33010844 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
33010799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 39569513 - 39569468
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39569513 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
39569468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 39982289 - 39982334
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39982289 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
39982334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 51290575 - 51290620
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51290575 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
51290620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 2482690 - 2482645
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2482690 |
atcatggttgcaccccaaaatgacaatattaccctttcataaaatt |
2482645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 13942169 - 13942214
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13942169 |
atcatggttgcaccccaaaatgacaagattatcctttcataaaatt |
13942214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 15932812 - 15932857
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15932812 |
atcatggttgcaccccaaaatgacaagattatcctttcataaaatt |
15932857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 20581525 - 20581570
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
20581525 |
atcatggttgcaccccaaaatgacaaaattaccctttcataaaatt |
20581570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 28852977 - 28852932
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28852977 |
atcatggttgcaccctaaaatgacaagattaccctttcataaaatt |
28852932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 34270831 - 34270786
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34270831 |
atcatggttgcaccccaaaatgacaagattatcctttcataaaatt |
34270786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 40400059 - 40400104
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40400059 |
atcatggttgcaccccaaaatgacaatattaccctttcataaaatt |
40400104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 40536846 - 40536801
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40536846 |
atcatggttgcacctcaaaatgacaagattaccctttcataaaatt |
40536801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 42948215 - 42948260
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42948215 |
atcatggttgcaccctaaaatgacaagattaccctttcataaaatt |
42948260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 44721897 - 44721942
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44721897 |
atcatggttgcaccccaaaatgataagattaccctttcataaaatt |
44721942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 49823230 - 49823275
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
49823230 |
atcatggttgcaccccaaaatgacaagattacccttttataaaatt |
49823275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 50727823 - 50727868
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
50727823 |
atcatggttgcaccccaaaatgacaagattatcctttcataaaatt |
50727868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 52024751 - 52024796
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
52024751 |
atcatggttgcaccccaaaatgacaggattaccctttcataaaatt |
52024796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 52044447 - 52044402
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52044447 |
atcatggttgcaccccaaaatgataagattaccctttcataaaatt |
52044402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 2138303 - 2138258
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
2138303 |
atcatggttgcacctcaaaatgataagattaccctttcataaaatt |
2138258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 26151223 - 26151178
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
26151223 |
atcatggttgcaccccaaaatgataagattatcctttcataaaatt |
26151178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 371 - 412
Target Start/End: Original strand, 40498647 - 40498688
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40498647 |
tggttgcaccccaaaatgacaaaattaccctttcataaaatt |
40498688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 18909241 - 18909286
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
18909241 |
atcatggttgcattccaaaatgacaatattaccctttcataaaatt |
18909286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 371 - 412
Target Start/End: Complemental strand, 29922279 - 29922238
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
29922279 |
tggttgcaccctaaaatgacaaaattaccctttcataaaatt |
29922238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 371 - 412
Target Start/End: Original strand, 7009038 - 7009079
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||| ||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
7009038 |
tggttacaccccaaaataacaaaattaccctttcataaaatt |
7009079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 371 - 412
Target Start/End: Complemental strand, 23444398 - 23444357
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||| |
|
|
| T |
23444398 |
tggttgcaccccacaatgacaaaattatcctttcataaaatt |
23444357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 48933241 - 48933286
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||| |||||||| || ||||||||| ||||||||| |
|
|
| T |
48933241 |
atcatggttgcacctcaaaatgataaaattacccttccataaaatt |
48933286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 371 - 412
Target Start/End: Original strand, 51776059 - 51776100
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||| ||||||||| |
|
|
| T |
51776059 |
tggttgcatcccaaaatgacaaaattacccttccataaaatt |
51776100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0438 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: scaffold0438
Description:
Target: scaffold0438; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 2173 - 2128
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2173 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
2128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0391 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: scaffold0391
Description:
Target: scaffold0391; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 3901 - 3946
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3901 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
3946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0276 (Bit Score: 46; Significance: 4e-17; HSPs: 2)
Name: scaffold0276
Description:
Target: scaffold0276; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 12546 - 12591
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12546 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
12591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0276; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 14107 - 14062
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||||| | ||||||| |||||||||||||| |
|
|
| T |
14107 |
atcatggttgcaccccaaaattataagattatcctttcataaaatt |
14062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 4e-17; HSPs: 32)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 3137282 - 3137237
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3137282 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
3137237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 8376266 - 8376311
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8376266 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
8376311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 11587924 - 11587969
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11587924 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
11587969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 15839481 - 15839526
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15839481 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
15839526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 17601360 - 17601405
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17601360 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
17601405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 24822781 - 24822736
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24822781 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
24822736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 26290836 - 26290791
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26290836 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
26290791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 26304093 - 26304048
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26304093 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
26304048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 26337448 - 26337403
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26337448 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
26337403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 28885769 - 28885724
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28885769 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
28885724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 28909688 - 28909733
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28909688 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
28909733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 39365272 - 39365317
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39365272 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
39365317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 408
Target Start/End: Complemental strand, 3032955 - 3032914
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataa |
408 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3032955 |
atcatggttgcaccccaaaatgacaagattaccctttcataa |
3032914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 5988214 - 5988259
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5988214 |
atcatggttgcaccccaaaatgacaatattaccctttcataaaatt |
5988259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 8013982 - 8013937
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8013982 |
atcatggttgcactccaaaatgacaagattaccctttcataaaatt |
8013937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 17122116 - 17122161
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
17122116 |
atcatggttgcaccccaaaataacaagattaccctttcataaaatt |
17122161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 23357314 - 23357269
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23357314 |
atcatggttgcaccccaaaatgacaagattaccttttcataaaatt |
23357269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 26122583 - 26122538
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26122583 |
atcatggttgcaccccaaaatgataagattaccctttcataaaatt |
26122538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 34917564 - 34917609
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34917564 |
atcatggatgcaccccaaaatgacaagattaccctttcataaaatt |
34917609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 35605363 - 35605408
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35605363 |
atcatggttgcacctcaaaatgacaagattaccctttcataaaatt |
35605408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 37578009 - 37578054
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37578009 |
atcatggttgcactccaaaatgacaagattaccctttcataaaatt |
37578054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 42512185 - 42512230
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42512185 |
atcatggttgcatcccaaaatgacaagattaccctttcataaaatt |
42512230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 43664382 - 43664337
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43664382 |
atcatggttgcacctcaaaatgacaagattaccctttcataaaatt |
43664337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 5599918 - 5599873
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5599918 |
atcatggttgcattccaaaatgacaagattaccctttcataaaatt |
5599873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 5640702 - 5640747
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5640702 |
atcatggttgcattccaaaatgacaagattaccctttcataaaatt |
5640747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 22439663 - 22439618
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
22439663 |
atcatggttacacctcaaaatgacaagattaccctttcataaaatt |
22439618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 34565086 - 34565041
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
34565086 |
atcatggttgcaccccaaaatgacaagattatccttttataaaatt |
34565041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 8656580 - 8656625
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||| || ||||||||||||||| |||||||||||||| |
|
|
| T |
8656580 |
atcatggttgcaaccaaaaatgacaagattaacctttcataaaatt |
8656625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 12713634 - 12713589
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||| |||||||| |
|
|
| T |
12713634 |
atcatggttgcaccccaaaatgacaatattacctttttataaaatt |
12713589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 371 - 412
Target Start/End: Original strand, 12722586 - 12722627
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
12722586 |
tggttgcaccccaaaatgacaaaattacccttccataaaatt |
12722627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 371 - 412
Target Start/End: Complemental strand, 31793903 - 31793862
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
31793903 |
tggttgcaccccaaaatgacaaaattacccttccataaaatt |
31793862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 371 - 412
Target Start/End: Complemental strand, 42687995 - 42687954
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
42687995 |
tggttgcaccccaaaatgacaaaattacccttccataaaatt |
42687954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 46; Significance: 4e-17; HSPs: 29)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 7790929 - 7790974
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7790929 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
7790974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 7900459 - 7900504
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7900459 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
7900504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 26015920 - 26015875
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26015920 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
26015875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 32542237 - 32542192
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32542237 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
32542192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 35924256 - 35924301
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35924256 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
35924301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 38876108 - 38876063
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38876108 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
38876063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 42095828 - 42095783
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42095828 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
42095783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 43247011 - 43246966
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43247011 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
43246966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 46322100 - 46322055
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46322100 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
46322055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 46923904 - 46923949
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46923904 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
46923949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 47065994 - 47065949
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47065994 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
47065949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 47779563 - 47779518
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47779563 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
47779518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 8203495 - 8203450
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8203495 |
atcatggttgcactccaaaatgacaagattaccctttcataaaatt |
8203450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 8215972 - 8215927
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8215972 |
atcatggttgcactccaaaatgacaagattaccctttcataaaatt |
8215927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 21279123 - 21279078
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
21279123 |
atcatggttgcaccccaaaatgacaagattatcctttcataaaatt |
21279078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 32662422 - 32662377
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32662422 |
atcatggttgcaccccaaaatgacaagattaccttttcataaaatt |
32662377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 38283645 - 38283600
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38283645 |
atcatggttgcaccccaaaatgacaatattaccctttcataaaatt |
38283600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 39074410 - 39074365
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39074410 |
atcatggttgcaccctaaaatgacaagattaccctttcataaaatt |
39074365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 40705566 - 40705521
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40705566 |
atcatggttgcaccccaaaatgacaagattgccctttcataaaatt |
40705521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 40995213 - 40995258
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40995213 |
atcatggttgcaccccaaaatgataagattaccctttcataaaatt |
40995258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 43047140 - 43047095
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43047140 |
atcatggttgcaccctaaaatgacaagattaccctttcataaaatt |
43047095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 25876802 - 25876847
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
25876802 |
atcatggttgcaccccaaaatgacaatattacccttttataaaatt |
25876847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 34591702 - 34591747
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
34591702 |
atcatggttgcacctcaaaatgacaagattatcctttcataaaatt |
34591747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 371 - 412
Target Start/End: Original strand, 20492714 - 20492755
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
20492714 |
tggttgcaccccaaaatgacaaaattacccttccataaaatt |
20492755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 21874685 - 21874640
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
21874685 |
atcatggttgcaccctaaaatgacaagattattctttcataaaatt |
21874640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 375 - 412
Target Start/End: Complemental strand, 42436554 - 42436517
Alignment:
| Q |
375 |
tgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42436554 |
tgcaccccaaaatgacaagattacccttccataaaatt |
42436517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 370 - 412
Target Start/End: Original strand, 27324984 - 27325026
Alignment:
| Q |
370 |
atggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||| ||||||||| ||||||| |||||||||||||| |
|
|
| T |
27324984 |
atggttgcactccaaaatgataagattatcctttcataaaatt |
27325026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 371 - 412
Target Start/End: Complemental strand, 39597923 - 39597882
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||| |||| ||| |||||||||| |
|
|
| T |
39597923 |
tggttgcaccccaaaatgacaaaattatcctgtcataaaatt |
39597882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 371 - 412
Target Start/End: Original strand, 43775913 - 43775954
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||| || |||| |||||||||||||| |
|
|
| T |
43775913 |
tggttgcaccccaaaatgataaaattatcctttcataaaatt |
43775954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 4e-17; HSPs: 12)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 29122412 - 29122367
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29122412 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
29122367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 29630554 - 29630509
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29630554 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
29630509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 3094614 - 3094659
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3094614 |
atcatggttgcaccccaaaatgacaatattaccctttcataaaatt |
3094659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 13890016 - 13889971
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13890016 |
atcatggttgcaccccaaaataacaagattaccctttcataaaatt |
13889971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 6167994 - 6167949
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
6167994 |
atcatggttgcaccctaaaatgacaagattaacctttcataaaatt |
6167949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 6625384 - 6625429
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
6625384 |
atcatggttgcaccctaaaatgacaagattatcctttcataaaatt |
6625429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 18893701 - 18893746
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18893701 |
atcatggttacaccccaaaatgacaagattatcctttcataaaatt |
18893746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 25335196 - 25335151
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
25335196 |
atcatggttgcacctcaaaatgacaagattatcctttcataaaatt |
25335151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 7141289 - 7141334
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||| ||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
7141289 |
atcatagttgcaccccaaaataacaagattatcctttcataaaatt |
7141334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 371 - 412
Target Start/End: Complemental strand, 31091199 - 31091158
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
31091199 |
tggttgcaccccaaaatgacaaaattacccttccataaaatt |
31091158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 374 - 412
Target Start/End: Original strand, 6925810 - 6925848
Alignment:
| Q |
374 |
ttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
6925810 |
ttgcaccccaaaatgacaaaattacccttccataaaatt |
6925848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 371 - 412
Target Start/End: Complemental strand, 34085898 - 34085857
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||| |||| |||| ||||||||| |
|
|
| T |
34085898 |
tggttgcaccccaaaatgacaaaattatccttccataaaatt |
34085857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 46; Significance: 4e-17; HSPs: 27)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 4156228 - 4156183
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4156228 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
4156183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 6469993 - 6469948
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6469993 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
6469948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 9065724 - 9065769
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9065724 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
9065769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 13145940 - 13145895
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13145940 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
13145895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 25084882 - 25084927
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25084882 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
25084927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 25142855 - 25142900
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25142855 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
25142900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 38760582 - 38760537
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38760582 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
38760537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 368 - 412
Target Start/End: Original strand, 24559095 - 24559139
Alignment:
| Q |
368 |
tcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24559095 |
tcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
24559139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 368 - 412
Target Start/End: Original strand, 24600127 - 24600171
Alignment:
| Q |
368 |
tcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24600127 |
tcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
24600171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 31527637 - 31527592
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31527637 |
atcatggttgcactccaaaatgacaagattaccctttcataaaatt |
31527592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 33280835 - 33280880
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33280835 |
atcatggttgtaccccaaaatgacaagattaccctttcataaaatt |
33280880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 43518351 - 43518306
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43518351 |
atcatggttgcaccccaaaatgacaagagtaccctttcataaaatt |
43518306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 371 - 412
Target Start/End: Original strand, 8232573 - 8232614
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8232573 |
tggttgcaccccaaaatgataagattaccctttcataaaatt |
8232614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 19034780 - 19034735
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
19034780 |
atcatggttgcaccccaaaataacaagattatcctttcataaaatt |
19034735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 19617782 - 19617737
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19617782 |
atcatagttgcaccccaaaataacaagattaccctttcataaaatt |
19617737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 29920316 - 29920361
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
29920316 |
atcatggttgcacctcaaaataacaagattaccctttcataaaatt |
29920361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 43293717 - 43293672
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
43293717 |
atcatggttgcaccccaaaatgacaagattatccttttataaaatt |
43293672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 371 - 412
Target Start/End: Original strand, 7338650 - 7338691
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
7338650 |
tggttgcaccccaaaatgacaaaattaccttttcataaaatt |
7338691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 371 - 412
Target Start/End: Complemental strand, 10666192 - 10666151
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
10666192 |
tggttgcaccccaaaatgacaaaattacccttccataaaatt |
10666151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 371 - 412
Target Start/End: Original strand, 18864460 - 18864501
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
18864460 |
tggttgcaccctaaaatgacaaaattaccctttcataaaatt |
18864501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 371 - 412
Target Start/End: Original strand, 31484679 - 31484720
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
31484679 |
tggttgcaccccaaaatgacaaaattacccttccataaaatt |
31484720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 36294207 - 36294252
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
36294207 |
atcatggttacaccccaaaatgacaaaattacccttccataaaatt |
36294252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 37865901 - 37865946
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||| ||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
37865901 |
atcatgattgcaccccaaaatgacaaaattatcctttcataaaatt |
37865946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 371 - 412
Target Start/End: Original strand, 40738922 - 40738963
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
40738922 |
tggttgcaccctaaaatgacaaaattaccctttcataaaatt |
40738963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 374 - 412
Target Start/End: Complemental strand, 37274667 - 37274629
Alignment:
| Q |
374 |
ttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
37274667 |
ttgcaccccaaaatgacaaaattacccttccataaaatt |
37274629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 371 - 412
Target Start/End: Original strand, 4621176 - 4621217
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||| || |||||||||| ||||||||||||||||||| |
|
|
| T |
4621176 |
tggttgcatcctaaaatgacaaaattaccctttcataaaatt |
4621217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 371 - 412
Target Start/End: Complemental strand, 41881975 - 41881934
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||| |||||| || ||||||||| |
|
|
| T |
41881975 |
tggttgcaccccaaaatgacaaaattacctttccataaaatt |
41881934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 4e-17; HSPs: 34)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 613849 - 613894
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
613849 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
613894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 20434188 - 20434233
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20434188 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
20434233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 20737716 - 20737761
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20737716 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
20737761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 39540473 - 39540428
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39540473 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
39540428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 42724253 - 42724208
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42724253 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
42724208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 52913265 - 52913220
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52913265 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
52913220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 53036087 - 53036042
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53036087 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
53036042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 53875182 - 53875137
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53875182 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
53875137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 55219893 - 55219938
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55219893 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
55219938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 56018765 - 56018720
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56018765 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
56018720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 56362844 - 56362889
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56362844 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
56362889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 10542104 - 10542059
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10542104 |
atcatggttgcaccccaaaatgacaatattaccctttcataaaatt |
10542059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 19874194 - 19874149
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19874194 |
atcatggttgcaccctaaaatgacaagattaccctttcataaaatt |
19874149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 25857566 - 25857611
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
25857566 |
atcatggttgcaccccaaaatgacaagattaccttttcataaaatt |
25857611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 28406510 - 28406465
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28406510 |
atcatggttgcaccccaaaatgacaagattatcctttcataaaatt |
28406465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 55215665 - 55215620
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
55215665 |
atcatggttgcaccccaaaatgacaagattatcctttcataaaatt |
55215620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 370 - 412
Target Start/End: Complemental strand, 37234274 - 37234232
Alignment:
| Q |
370 |
atggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37234274 |
atggttgcaccccaaaatgacaagattatcctttcataaaatt |
37234232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 23895267 - 23895222
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
23895267 |
atcatggttgcatcccaaaatgacaagattatcctttcataaaatt |
23895222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 42348686 - 42348731
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
42348686 |
atcatggttgcaccctaaaatgacaagattatcctttcataaaatt |
42348731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 43458463 - 43458418
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
43458463 |
atcatggttgcaccccaaaatgacaaaattacccttccataaaatt |
43458418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 43830289 - 43830244
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
43830289 |
atcatggttgcacctcaaaatgacaatattaccctttcataaaatt |
43830244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 52839804 - 52839759
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
52839804 |
atcatggttgcaccccaaaacgacaaaattaccctttcataaaatt |
52839759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 55183599 - 55183554
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
55183599 |
atcatggttgcaccccaaaatgataagattactctttcataaaatt |
55183554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 371 - 412
Target Start/End: Complemental strand, 22301812 - 22301771
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
22301812 |
tggttgcaccccaaaataacaaaattaccctttcataaaatt |
22301771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 371 - 412
Target Start/End: Complemental strand, 35339712 - 35339671
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
35339712 |
tggttgcaccctaaaatgacaagattacccttccataaaatt |
35339671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 38291927 - 38291882
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
38291927 |
atcatggttgcaccaaaaaatgacaagattaacctttcataaaatt |
38291882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 47467479 - 47467434
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||| ||||||||| |
|
|
| T |
47467479 |
atcatggttgcatcccaaaatgacaaaattacccttccataaaatt |
47467434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 377 - 412
Target Start/End: Original strand, 8713260 - 8713295
Alignment:
| Q |
377 |
caccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
8713260 |
caccccaaaatgacaaaattaccctttcataaaatt |
8713295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 371 - 412
Target Start/End: Complemental strand, 49393 - 49352
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||| | |||||||||| ||||||||||||||||||| |
|
|
| T |
49393 |
tggttgcactctaaaatgacaaaattaccctttcataaaatt |
49352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 371 - 412
Target Start/End: Original strand, 24034548 - 24034589
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
24034548 |
tggttgtaccccaaaatgacaaaattacccttccataaaatt |
24034589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 371 - 412
Target Start/End: Original strand, 24897015 - 24897056
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||| |||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
24897015 |
tggttacaccccaaaatgacaaaattactctttcataaaatt |
24897056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 31709741 - 31709786
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||| |||||||| |
|
|
| T |
31709741 |
atcatggttgcaccttaaaatgacaagattatccttttataaaatt |
31709786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 371 - 412
Target Start/End: Original strand, 40430152 - 40430193
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
40430152 |
tggttgcaccctaaaatgacaaaattacccttccataaaatt |
40430193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 52307529 - 52307484
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||| || ||||||| ||||||| |||||||||||||| |
|
|
| T |
52307529 |
atcatggttgcatcctaaaatgataagattatcctttcataaaatt |
52307484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 46; Significance: 4e-17; HSPs: 31)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 84414 - 84459
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
84414 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
84459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 10841503 - 10841458
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10841503 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
10841458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 10999817 - 10999772
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10999817 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
10999772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 20048360 - 20048405
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20048360 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
20048405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 20835653 - 20835608
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20835653 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
20835608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 24395121 - 24395166
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24395121 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
24395166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 25710912 - 25710957
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25710912 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
25710957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 32236158 - 32236203
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32236158 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
32236203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 38871146 - 38871191
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38871146 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
38871191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 40586242 - 40586197
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40586242 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
40586197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 4044879 - 4044834
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4044879 |
atcatggttgcaccccaaaataacaagattaccctttcataaaatt |
4044834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 4516085 - 4516040
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4516085 |
atcatggttgcaccctaaaatgacaagattaccctttcataaaatt |
4516040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 7679768 - 7679723
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7679768 |
atcatggttgcactccaaaatgacaagattaccctttcataaaatt |
7679723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 20657458 - 20657413
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
20657458 |
atcatggttgcactccaaaatgacaagattaccctttcataaaatt |
20657413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 22781978 - 22781933
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
22781978 |
atcatggttgcaccacaaaatgacaagattaccctttcataaaatt |
22781933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 26090227 - 26090272
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26090227 |
atcatggttgcacctcaaaatgacaagattaccctttcataaaatt |
26090272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 33712694 - 33712649
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33712694 |
atcatggttgcaccctaaaatgacaagattaccctttcataaaatt |
33712649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 33966921 - 33966966
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33966921 |
atcatggttgcatcccaaaatgacaagattaccctttcataaaatt |
33966966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 37971745 - 37971700
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37971745 |
atcatggttgcaccccaaaatgacaagattatcctttcataaaatt |
37971700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 53974336 - 53974381
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
53974336 |
atcatggttgcaccccaaaatgacaagattacccattcataaaatt |
53974381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 672093 - 672138
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
672093 |
atcatggttgcactccaaaatgataagattaccctttcataaaatt |
672138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 7156742 - 7156697
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
7156742 |
atcatggttgcatcccaaaatgataagattaccctttcataaaatt |
7156697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 36430293 - 36430338
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
36430293 |
atcatggttgcaccccaaaatgacaagattactctttgataaaatt |
36430338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 374 - 412
Target Start/End: Complemental strand, 6268422 - 6268384
Alignment:
| Q |
374 |
ttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6268422 |
ttgcaccccaaaatgacaagattaccctttcctaaaatt |
6268384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 371 - 412
Target Start/End: Original strand, 35039602 - 35039643
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
35039602 |
tggttgcaccccaaaatgacaaaattacccttccataaaatt |
35039643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 371 - 412
Target Start/End: Complemental strand, 36232738 - 36232697
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
36232738 |
tggttgcaccctaaaatgacaaaattaccctttcataaaatt |
36232697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 371 - 412
Target Start/End: Complemental strand, 36885807 - 36885766
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
36885807 |
tggttgcaccctaaaatgacaaaattaccctttcataaaatt |
36885766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 371 - 412
Target Start/End: Complemental strand, 38145307 - 38145266
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
38145307 |
tggttgcaccctaaaatgacaaaattaccctttcataaaatt |
38145266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 41069862 - 41069906
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41069862 |
atcatggttgcacct-aaaatgacaagattaccctttcataaaatt |
41069906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 371 - 412
Target Start/End: Complemental strand, 7681070 - 7681029
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
7681070 |
tggttgcaccctaaaatgacaaaattacccttccataaaatt |
7681029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 371 - 412
Target Start/End: Original strand, 11123888 - 11123929
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||| |||||||||||||| ||||||||| ||||||||| |
|
|
| T |
11123888 |
tggttgcgccccaaaatgacaaaattacccttccataaaatt |
11123929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 46; Significance: 4e-17; HSPs: 23)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 927090 - 927135
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
927090 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
927135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 1481837 - 1481882
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1481837 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
1481882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 13196196 - 13196151
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13196196 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
13196151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 15011845 - 15011890
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15011845 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
15011890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 25853491 - 25853446
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25853491 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
25853446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 32551726 - 32551681
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32551726 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
32551681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 44143386 - 44143431
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44143386 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
44143431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 45505844 - 45505799
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45505844 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
45505799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 1520202 - 1520247
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1520202 |
atcatggttgcaccccaaaatgataagattaccctttcataaaatt |
1520247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 10638804 - 10638849
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10638804 |
atcatggttgcaccctaaaatgacaagattaccctttcataaaatt |
10638849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 35895518 - 35895563
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35895518 |
atcatggttgcactccaaaatgacaagattaccctttcataaaatt |
35895563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 39697836 - 39697791
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39697836 |
atcatagttgcaccccaaaatgacaagattaccctttcataaaatt |
39697791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 43577029 - 43577074
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43577029 |
atcatggttgcaccctaaaatgacaagattaccctttcataaaatt |
43577074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 2390745 - 2390700
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
2390745 |
atcatggttgcaccctaaaatgacaagattatcctttcataaaatt |
2390700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 3178252 - 3178297
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
3178252 |
atcatggttgcaccctaaaatgataagattaccctttcataaaatt |
3178297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 21657953 - 21657998
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
21657953 |
atcatggttgcaccctaaaatgacaagattatcctttcataaaatt |
21657998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 27980970 - 27980925
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27980970 |
atcatggttacaccccaaaatgacaagattatcctttcataaaatt |
27980925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 28067500 - 28067455
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28067500 |
atcatggttacaccccaaaatgacaagattatcctttcataaaatt |
28067455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 34202305 - 34202350
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34202305 |
atcatggttacaccccaaaatgacaagattatcctttcataaaatt |
34202350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 40811831 - 40811786
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
40811831 |
atcatggttgcaccccaaaatgaaaagattatcctttcataaaatt |
40811786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 42342994 - 42343039
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
42342994 |
atcatggttgcaccccaaaatgataagattatcctttcataaaatt |
42343039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 371 - 412
Target Start/End: Complemental strand, 4331936 - 4331895
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||| || |||||||||| ||||||||||||||||||| |
|
|
| T |
4331936 |
tggttgcatcctaaaatgacaaaattaccctttcataaaatt |
4331895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 371 - 412
Target Start/End: Original strand, 26171006 - 26171047
Alignment:
| Q |
371 |
tggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||||| |||| ||||||||| ||||||||| |
|
|
| T |
26171006 |
tggttgcaccccaaaataacaaaattacccttccataaaatt |
26171047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0368 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0368
Description:
Target: scaffold0368; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Original strand, 13888 - 13933
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13888 |
atcatggttgcaccctaaaatgacaagattaccctttcataaaatt |
13933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 38470 - 38425
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38470 |
atcatggttgcactccaaaatgacaagattaccctttcataaaatt |
38425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0248 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: scaffold0248
Description:
Target: scaffold0248; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 3082 - 3037
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
3082 |
atcatggttgcaccccaaaatgacaatattacccttttataaaatt |
3037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 157173 - 157128
Alignment:
| Q |
367 |
atcatggttgcaccccaaaatgacaagattaccctttcataaaatt |
412 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
157173 |
atcatggttgcaccaaaaaatgacaagattaccctttcataaaatt |
157128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University