View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7550_high_39 (Length: 375)
Name: NF7550_high_39
Description: NF7550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7550_high_39 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 1 - 367
Target Start/End: Complemental strand, 12911280 - 12910913
Alignment:
| Q |
1 |
ggtctacatcagtcattttttctattttattttacagttattggtcaccacaatttacactacccacaacccaccattatccttcatcatgaggttt-at |
99 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || |
|
|
| T |
12911280 |
ggtccacatcggtcattttttctattttattttacagttattggtcaccacaatttacactacccacaacccaccattatccttcataatgaggttttat |
12911181 |
T |
|
| Q |
100 |
gacagtaagggatcagcatcggtcggttacgggtggattcggcccaataactgctcaccgaagaacacccgtagatcagaaaatgtgaaccattcccgac |
199 |
Q |
| |
|
||||||||||| || |||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12911180 |
gacagtaaggggtcggcatcggtcggttacgggcggattcggcccaacaactgctcaccgaagaacacccgtagatcagaaaacgtgaaccattcccgac |
12911081 |
T |
|
| Q |
200 |
cgtttcaacgtcagtttcggcaggtgacgggtctaacggaataacgggtgagccgggtggtttggctcggttgtatctctagctttcatctgcgaaaatg |
299 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12911080 |
cgtttcaacgtcagtttcggcgggtgacgggtctaacggaataacggttggtccgggtggtttggctcggttgtatctctagctttcatctgcgaaaatg |
12910981 |
T |
|
| Q |
300 |
ttcttctcctctctgtatatctctcatctcatgtgcttcgtgttcattccctgttcttgtttcttctc |
367 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12910980 |
ttcttctcctctctgtatatctctcatctcatgtgcttcgtgttcattccctgttcttgtttcttctc |
12910913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University