View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7550_high_59 (Length: 276)

Name: NF7550_high_59
Description: NF7550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7550_high_59
NF7550_high_59
[»] chr7 (1 HSPs)
chr7 (15-74)||(1701949-1702008)


Alignment Details
Target: chr7 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 15 - 74
Target Start/End: Original strand, 1701949 - 1702008
Alignment:
15 gaagaagtgctgttgagttgcagcattgagaaaaaatcggtttcttgttggtcaagaaac 74  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1701949 gaagaagtgctgttgagttgcagcattgagaaaaaatcggtttcttgttggtcaagaaac 1702008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University