View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7550_high_62 (Length: 266)

Name: NF7550_high_62
Description: NF7550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7550_high_62
NF7550_high_62
[»] chr8 (2 HSPs)
chr8 (152-250)||(37258116-37258214)
chr8 (1-96)||(37258264-37258359)


Alignment Details
Target: chr8 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 152 - 250
Target Start/End: Complemental strand, 37258214 - 37258116
Alignment:
152 gatgaagttgacgttggatagtggataatgatgattgtgcatatttgccactttgtactcatctaaattgtcaagttcaattgattgactttaaggata 250  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37258214 gatgaagttgacgttggatagtggataatgatgattgtgcatatttgccactttgtactcatctaaattgtcaagttcaattgattgactttaaggata 37258116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 37258359 - 37258264
Alignment:
1 ccaccacccactcatcgtcggttctaacatatcagcaatgatacagacaagacaccgattcatgagaaatgttggtgctggagaattcttaattac 96  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37258359 ccaccacccactcatcgtcggttctaacatatcagcaatgatacagacaagacaccgattcatgagaaatgttggtgctggagaattcttaattac 37258264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University