View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7550_low_102 (Length: 203)
Name: NF7550_low_102
Description: NF7550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7550_low_102 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 1 - 188
Target Start/End: Original strand, 20531093 - 20531279
Alignment:
| Q |
1 |
tgtaattctgtcaaactcattgtcaatcaaagtaaagcacttaaatgattgtattgttaattttatgtatgtagagcgcactttcaataagccaacaatt |
100 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20531093 |
tgtaattctgtcaaactcattg-caaacaaagtaaagctattaaatgattgtattgttaattttatgtatgtagagcgcactttcaataagccaacaatt |
20531191 |
T |
 |
| Q |
101 |
ggaatgctataaggactaccaaaaagaactagtgaaaattgctgggagatcaaatgcatcatcaattatatctggtgctgtatatatt |
188 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20531192 |
ggaatgctataaggactaccaagaagaactagtgaaaattgctgggagatcaaatgcatcatcaattatatctggtgctgtatatatt |
20531279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University