View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7550_low_21 (Length: 490)
Name: NF7550_low_21
Description: NF7550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7550_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 16 - 309
Target Start/End: Complemental strand, 3012588 - 3012302
Alignment:
| Q |
16 |
aatttgtccaaatttgcaagacttagtgctgaaaccatcaccataaactcttcaaaaatgtggaaaatcaagtaaatttcatggtagggggcgtagcagg |
115 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | | |
|
|
| T |
3012588 |
aatttgtccaaattcgcaagacttagtgctgaaaccatcaccataaactcttcaaaaatgtggaaaatcaagtaaatttcatggcaggggg------acg |
3012495 |
T |
 |
| Q |
116 |
ctagcagccctatccagtacttagttttgtggtttttctctttgtgaattttaataatcttgtgtaattaggttcacttaactcatatggttgatgaatg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3012494 |
-tagcagccctatccagtacttagttttgtggtttttctctttgtgaattttaataatcttgtgtaattaggttcacttaactcatatggttgatgaatg |
3012396 |
T |
 |
| Q |
216 |
gaacgaagttagggtctcttgcggctataaaagggcttgtagtcttggcatttcatacacacacttcatagtaaactctagcaaactctcgtaa |
309 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3012395 |
gaacgaagttagggtctctttcggctataaaagggcttgtagtcttggcatttcatacacacacttcatagtaaactctagcaaactctcgtaa |
3012302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 86; E-Value: 7e-41
Query Start/End: Original strand, 405 - 490
Target Start/End: Complemental strand, 3012205 - 3012120
Alignment:
| Q |
405 |
tgctcatcactaggatgagtgaatagtttccttttgtatagtgattatgtaaagtaattcaatgattaattttaacattagcaaac |
490 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3012205 |
tgctcatcactaggatgagtgaatagtttccttttgtatagtgattatgtaaagtaattcaatgattaattttaacattagcaaac |
3012120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University