View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7550_low_38 (Length: 409)
Name: NF7550_low_38
Description: NF7550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7550_low_38 |
 | |
|
| [»] scaffold0009 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 1e-57; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 124 - 300
Target Start/End: Complemental strand, 28445576 - 28445392
Alignment:
| Q |
124 |
aacacaagtttgaggaagaactgtgtggcaacattttttggtgcatgtcttgtttgcagcctcggcagaaaaacatagaaaagcaaaa---------tca |
214 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |||||||||||||| |||| |||| ||| |
|
|
| T |
28445576 |
aacacaggtttgaggaagaactgtgtagcaacattttttggtgcatgtcttgtttgcagcgtaggcagaaaaacataaaaaaaaaaaaaaaaaaaaatca |
28445477 |
T |
|
| Q |
215 |
ccatgaagtactaatttgaattgacaccatatgagacttgttttacctctattctagatctctatcttgcaagtgtcgggacttcc |
300 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28445476 |
ccatgaagtactaatttgaatcgacaccatat-agacttgttttacctctattctagatctctatcttgcaagtgtcgggacttcc |
28445392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 323 - 388
Target Start/End: Complemental strand, 28445022 - 28444957
Alignment:
| Q |
323 |
ctggattttaatttgatagtattttacgtagctgacctatgtagaagatagttggagcactgaacc |
388 |
Q |
| |
|
||||||| |||||||| |||||| || ||||||||||||||||| | ||||| ||| ||||||||| |
|
|
| T |
28445022 |
ctggattataatttgacagtattatatgtagctgacctatgtagcatatagtaggaacactgaacc |
28444957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 243 - 388
Target Start/End: Original strand, 33101902 - 33102049
Alignment:
| Q |
243 |
atatgagacttgttttacctctattctagatctctatcttgcaagtgtcgggacttccnnnnnnnnnn--tcttcatgaactctggattttaatttgata |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| | |
|
|
| T |
33101902 |
atatgagacttgttttacctctattctagatctctatcttgcaagtgtcgggacttccacaaaaaaaaaatcttcatcaactctggattttaatttgaca |
33102001 |
T |
|
| Q |
341 |
gtattttacgtagctgacctatgtagaagatagttggagcactgaacc |
388 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33102002 |
gtattttaagtagctgacctatgtagaagatagttggagcactgaacc |
33102049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 92; Significance: 1e-44; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 243 - 388
Target Start/End: Original strand, 92718 - 92863
Alignment:
| Q |
243 |
atatgagacttgttttacctctattctagatctctatcttgcaagtgtcgggacttccnnnnnnnnnntcttcatgaactctggattttaatttgatagt |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||| || ||||||| |||| ||||||||||||||| ||| |
|
|
| T |
92718 |
atatgagacttgttttacctctattctagatctctatcttgcaagtatcgggacatcggaaaaaaaaatcttcatcaactttggattttaatttgacagt |
92817 |
T |
|
| Q |
343 |
attttacgtagctgacctatgtagaagatagttggagcactgaacc |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
92818 |
attttacgtagctgacctatgtagaagatagttggagcactgaacc |
92863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University