View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7550_low_53 (Length: 348)
Name: NF7550_low_53
Description: NF7550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7550_low_53 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 97 - 329
Target Start/End: Original strand, 43577212 - 43577439
Alignment:
| Q |
97 |
ctctgcagaaaccttat-aaagacctaacggttttcattcttctcttctcatcttcaactttcaactcactgtcttcgcccannnnnnnnnnnnnnnnnn |
195 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43577212 |
ctctgcagaaaccttattaaagacctaacggttttcattcttctcttctcatcttcaactttcaactcactgtcttcgccctttttttttctttttcttt |
43577311 |
T |
 |
| Q |
196 |
caactcattgctttctttgaaaattacaaagtaatgaagttttttcaggaaggagtgagatctaacatggtgagcaatagcatctttgagtaatgtagtt |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43577312 |
caactcattgctttctttgaaaattacaaagtaatgaagttttttcaggaaggagtgagatctaacatggt------tagcatctttgagtaatgtagtt |
43577405 |
T |
 |
| Q |
296 |
ccttttatttattccatatattcactgacacact |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
43577406 |
ccttttatttattccatatattcactgacacact |
43577439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 43577116 - 43577152
Alignment:
| Q |
1 |
cgtgaaatgctcgggagcactactctattaaaatctc |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43577116 |
cgtgaaatgctcgggagcactactctattaaaatctc |
43577152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University