View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7550_low_65 (Length: 279)
Name: NF7550_low_65
Description: NF7550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7550_low_65 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 11 - 261
Target Start/End: Original strand, 34976849 - 34977099
Alignment:
| Q |
11 |
aagaatatgagaggaaaatggtatacaatgtgcatggtataatataattacctgcaaccaatgatctgcagatgattccatattgcagacgtgaagagag |
110 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34976849 |
aagaaaatgagagggaaatggtatacaatgtgcatggtataatataattacctgcaaccaatgatctgcagatgattccatattgcagacgtgaagagaa |
34976948 |
T |
 |
| Q |
111 |
gataaacccattcaaaagccaagctcagagttgtgatcaagcagtgtagttagctaaactaaaagtgcaactattagctagcatcagtgagttattgcca |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34976949 |
gataaacccattcaaaagccaagctcagagttgtgatcaagcagtgtagttagctaaactaaaagtgcaactattagctagtatcagtgagttattgcca |
34977048 |
T |
 |
| Q |
211 |
ttgcattgcaaagagagaatagaagaaaatgaaagaggctagtgttatttg |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34977049 |
ttgcattgcaaagagagaatagaagaaaatgaaagaggatagtgttatttg |
34977099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University